jerrell2145 jerrell2145

22-01-2024
History

contestada

The remarkable oral tradition of sub-Saharan Africa was preserved primarily by ________.

Respuesta :

Otras preguntas

hwlp i give 5 stars

How might hummurabi argue that laws 215 and 218 were just?

Mrs. Sing invests $12,876 for her business at an annual interest rate of 7 percent for 3 years. Which number will Mrs. Sing substitute for r in the simple inter

A command or order is a(n):

With wireless Internet (WiFi) gaining popularity, the number of public wireless Internet access points (in thousands) is projected to grow from 2003 to 2008 acc

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

According to the following balanced reaction, how many moles of CaO are required to exactly react with 5.44 moles of H₂O? 4 CaO(s) + 2 H₂O(1)→ 4 CaOH(s) + O₂(g)

Term: Swath Mapping List 3 things that can the feature (swath mapping) can be found:

Identify the rectangular form corresponding to the parametric equations x left parenthesis t right parenthesis space equals space 4 t cubed minus 1 and y left p

The average speed of a car on its last journey was 40 mph. On its current journey, the average speed of the car is 70 mph. What is the percentage increase in th