nicolesune35
nicolesune35 nicolesune35
  • 22-09-2014
  • Mathematics
contestada

the moon is about 240,000 miles from earth .What is the distance written as a whole number multiplied by a power of ten?

Respuesta :

Trim
Trim Trim
  • 22-09-2014
240,000

= 24,000 x 10^1
= 2,400 x 10^2
= 240 x 10^3
= 24 x 10^4
= 2.4 x 10^5
Answer Link
Аноним Аноним
  • 22-09-2014
[tex]24\underbrace{0,000}_{\leftarrow4}\ miles=24\times10^4\ \ miles[/tex]
Answer Link

Otras preguntas

Solve for the roots in simplest form using the quadratic formula: 4x^2? +21 = -20x
Empareja la forma correcta de saber o conocer para completar la frase. Match the correct form of the verb saber or conocer to complete the sentence. (4 points)
Who was president of the u. S. When texas became a state?.
Early People in the Central American Land Bridge by James Folta Here the code for the nearpod: V4UYF
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
an account is with an initial deposit of $1500 earns 7 percent interest for 1.5 years what is the ending balance enter your answer in the box
Please help I will give brainliest
Based on your knowledge of Europe in 1938, what two countries are distinctly missing from the conference? What impact do you think this will have on world affai
English please help tysm 20 points and brainliest
ASAP PLSSSSSSS I need help with this homework