mizfa0lott1yfasa
mizfa0lott1yfasa mizfa0lott1yfasa
  • 22-06-2016
  • Chemistry
contestada

The residue of coal decomposition that is used in the manufacture of steel is called: 1. coal gas 2. coke 3. coal tar

Respuesta :

taskmasters
taskmasters taskmasters
  • 29-06-2016
The correct answer from the choices given is option 3. Coal tar is the residue of coal decomposition that is used in the manufacture of steel. It is a brown to black liquid with very high viscosity. It is a by-product when coal is carbonized or gasified. This substance contains a mixture of many substances.
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius
Can anyone to correct it if necessary?
Can anyone to correct it if necessary? Thank you.
An air force plane flew to Jakarta and back. On the trip there it flew 480 km/h and on the return trip it went 288 km/h. How long did the trip there take if the
how many atoms are present in 4.0 mol of sodium
What is the source Code of transcription
the surface of water connect like a sort of sort of skin due to property of liquids called
Which university was the first to grant a woman a Ph.D. in America?
which of the following are examples of ways humans and plants have coevolved? Pick all that apply A. Humans have bred plants to use as food B. Plants provide a