zah963319
zah963319 zah963319
  • 26-02-2020
  • Biology
contestada

How do plant cells work together to move nutrients

Respuesta :

Chewbacca1
Chewbacca1 Chewbacca1
  • 26-02-2020

Answer:

Plants absorb nutrients and water through their roots, but photosynthesis — the process by which plants create their fuel — occurs in the leaves. ... The leaves of plants also contain veins, through which nutrients and hormones travel to reach the cells throughout the leaves.

Explanation:

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Suppose a pizza must fit into a box with a base that is 12 inches wide. You can use the quadratic function a=(Pi)r^2 to find the area of a pizza in terms of its
Can anyone help? My teacher just briefly went over this in notes and I can't really decipher between physical and chemical changes in the examples
6 is 12% of what number
Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !
What is the source Code of transcription
The spread of ideas during the Renaissance was MOST affected by. A) luthers religious conversion. B) the support of the Catho
In a cell if ΨP = +0.3MPa and ΨS=-0.45MPa, then the resulting Ψ is ___. Enter your answer with either a + or a - before the number and no words.
What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?
what is 7/8ths of 40