shemeriahubbard shemeriahubbard

22-03-2020
Mathematics

contestada

Jessica has twice as many books as Andrew. Together, they have 36 books. How many books does Jessica have?

Respuesta :

brookea472 brookea472

22-03-2020

Answer:

24

Step-by-step explanation:

Answer Link

Otras preguntas

if an element has more than one ionic change how is that piece of information represented in the chemical name

Look At The Picture. Thats The Question I Need Answered ASAP

Sharp pain is transmitted through which type of nerve fibers?

help answer ASAPPP 10 points

How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What two countries on opposite sides of the ring of fire were shaken by major earthquakes last weekend

· Heart muscle receives its oxygen and nutrient supply from o atria o ventricles o aorta o pulmonary veins o coronary arteries · The "cushion" between bones in

A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut

What event takes place in the second entry of Anne Frank's dairy?