julzm03 julzm03
  • 22-04-2020
  • Mathematics
contestada

7
A circle has a central angle measuring 10 radians that intersects an arc of length 33 cm. What is the length of the radius of the
circle? Round your answer to the nearest whole cm. Use 3.14 for
11 cm
15 cm
22 cm
41 cm
Save and Exit
Submit

Respuesta :

TheGreatWoozie
TheGreatWoozie TheGreatWoozie
  • 22-04-2020

The answer is B. 15 cm

Answer Link

Otras preguntas

Which viruse reproduces & what reproductive cell ?
A cubic centimeter holds 1 milliliter of liquid. How many liters of water to the nearest tenth are required to fill a fish tank that is 24 centimeters high, 28
omega 3 fatty acids are important because they
What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Helpp Pleasee ASAPPPPP
how are the four earths systems connected
what are the chromosome numbers of daughter cells in mitosis and meiosis
calculate the perimeter of a quadrilateral 3 cm 2 cm 2 cm 5 cm
. The production of fatty acids is dependent on bicarbonate, but radioactive bicarbonate is not incorporated into the new fatty acid. What could be the reason f