junco3160
junco3160 junco3160
  • 23-04-2020
  • History
contestada

As a result of Andrew Jackson's 1818 actions in Florida...
​

Respuesta :

hawanawabi18
hawanawabi18 hawanawabi18
  • 23-04-2020
From 1817-1818, the United States Army invaded Spanish Florida and fought against the Seminole and their African American allies. Collectively, these battles came to be known as the First Seminole War. Americans reacted to these confrontations by sending Andrew Jackson to Florida with an army of about 3,000 men.
Answer Link

Otras preguntas

the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch
Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
plz help what is the answer.
How do bones in a fossil survive for millions of years?
Your grandma thinks that the theory of evolution can't be possible because she has never seen a monkey turn into a human. How could you convince her otherwise?
blank thousands equals 1800 tens
Discuss at least two effects on U.S. citizens that stem from the division of power between the federal and state governments.
only question 4 thank you
What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds