helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

What president intergrated the us armed forces in 1948

what is the past tense of the verb below for the subject pronoun nosotros Estudiar

Martha bought blueberries in Minnesota that contained a USDA Organic Certification sticker. The blueberries were grown using genetically modified organisms. Th

The sun rose over the mountain is this sentence a transitive or a intransitive

help me pls... this is my last question... brainiest 4 first answer and if u r right Most Africans live _____. A. south of the Sahara B. north of the Sahara

which of the following is a sport found in north america? chess hockey baseball all of the above

Consider the setting, details, and plot of “La Belle Dame…” Which Romantic characteristic is NOT represented very strongly in this poem? nature inspires/brings

why does an increase in the number of people who are older than 65 worry some people?

Read the passage. “I been in bed so much I done some thinking. I know about people. I know about me. And him. He can’t hurt you: but if you stand out of the way

Siblings raised together have higher similarity in iq than siblings reared apart. please select the best answer from the choices provided t f