dawnlyha
dawnlyha dawnlyha
  • 23-09-2016
  • Mathematics
contestada

7x_=(7x4)+(7x3) how do I solve this

Respuesta :

Аноним Аноним
  • 23-09-2016
easy 7x3 is first then 7x4 then         7x5=7x_
Answer Link

Otras preguntas

Can someone please help!
mention six dangers posed by the activities of pressure groups​
Julie had 3 1/3cups of flour. A brownie called for 1 1/3 of flour. If julie made one batch of brownies,how many more batches could she make?​
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
ill mark brainlyist I'm in a hurry
Why was it unfair for the state of Kansas to force Linda to go to Monroe Elementary School instead of letting her go to Sumner Elementary School?
Any member of the public can buy stock in a __________ corporation. A. nonprofit B. government C. privately-traded D. publicly-traded
Plz help asap..... it has to be a 5 sentence paragraph and here is the prompt Most media are brought to you by paid advertisements. In a well developed paragrap
Why are phase changes considered physical and not chemical changes?
A utopia is a society: O A. that has fallen apart and is negative. B. in which good tools cause trouble. c. that has both bad and good aspects. D. in which ever