abdul112 abdul112
  • 22-11-2020
  • Mathematics
contestada

What's the first step into asking a division problem or question?

Respuesta :

anjelojay4
anjelojay4 anjelojay4
  • 22-11-2020

Answer:

You can create a little story of who gets what and how it needs to be shared.

You're going to need the context, the conflict, and lastly, the question. For example. 3 kids ordered 6 pizza slices. (Context) The kids want to split the pizzas evenly. (conflict) How many slices will each kid get? (Question) Hope this helped.

Btw the subject, conflict, ETC was made by me just to make it simpler.

Answer Link

Otras preguntas

1. What are some considerations in choosing a financial institution? Which one do you think would be the most important consideration for you in choosing a fina
what issues did uk face following ww2
Ice causes a crack to form in a rock. This is an example of mechanical weathering chemical weathering erosion molecular weathering
Peyer's patches are mucosa-associated lymph tissue located in the
How do sebaceous glands protect the skin normally
The War Production Board was responsible for shifting factories in America from producing consumer goods to producing military goods and artillery. t or f
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
m∠1 = _° a) 140 b) 160 c) 80
_________ are the undifferentiated goods in which one producer's product is differentiated from another producer's product; field corn and iceberg lettuce are e
quien compone un editorial?