taegkuk
taegkuk taegkuk
  • 26-02-2021
  • Biology
contestada

What is the answer to this question?

What is the answer to this question class=

Respuesta :

asmith1345 asmith1345
  • 08-03-2021

Answer:

unpredictable

Explanation:

relies on the heat

Answer Link

Otras preguntas

I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo
A 15.6 grams of ethanol absorb 868 J as it is heated. The initial temperature is 21.5 degrees Celsius. What is the final temperature if the specific heat of eth
Describe an internal characteristic that is similar in all people, but slightly different from person to person.
The SAT mathematics scores in the state of Florida are approximately normally distributed with a mean of 500 and a standard deviation of 100. Using the empiric
Derek is deciding what to wear to school. He has a green shirt, a purple shirt, and a red shirt, and he has beige, gray, and blue pants. He also has sandals, ru
.Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here
Rulers of the Zhou dynasty established the Mandate of Heaven to ________.
choose the correct helping verb the tadpoles have or had moved into the pond
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Each of the mutants listed below this paragraph has a different mutant form of the gene encoding protein X. Each mutant gene contains one or more nucleotide ins