kitanawhitener113 kitanawhitener113

22-11-2021
English

contestada

What is a narrative? A.a description of a topic B. a discussion C. a list of topics D. a true or imagined story

Respuesta :

rosyneedhelp rosyneedhelp

22-11-2021

Answer:

b.

Explanation:

cuz I took the test your welcome

Answer Link

Otras preguntas

Which of the following choices for staying safe is the best to attempt first when trying out a new activity? A. Follow the same routine that the experts use, an

Why are they called SH2 domains?

calculate the perimeter of a quadrilateral 3 cm 2 cm 2 cm 5 cm

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri

What is a telomere? What happens to telomeres each time DNA is replicated? How do cells prevent this from occurring?

in millions of british pounds how much did germany spend in 1890

Allergies are the most common type of immune system disorder. Describe an allergic reacion and explain why it may be harmful. (5 marks)

what the decimal of 2 1/4

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Do any of these represent a linear function (just state letters if they do)