kiwipitts142 kiwipitts142

23-11-2021
SAT

contestada

The scale on a map is 1 4 inch = 3 4 mile. How long is one mile on the map?.

Respuesta :

joshmontelus87 joshmontelus87

23-11-2021

Answer:

it would be 1/16+1/4=1

Explanation:

step by step explanation

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Justin is making cookies, using a recipe in which the ratio of flour to chocolate chips to sugar is 4: 2: 1 for each batch. a. If he is using 8 cups of flour ho

mbkhivhivkihvkilvFalse True

what was different about world war I in comparison to previous wars?a, it was old-school war meets new technologyb, all the technology fit right into the old s

How did Saeng 's internal conflict affected her confidence in passing her driving test?

Which of the following was not one of the new types of leisure activities developed around the year 1900? A. Going to the beach B. Riding a bicycle C. Going to

If you walked for 5 minutes, what would the ratio of feet to minutes be? Use your steps to minutes ratio from Task 1 to determine a ratio of feet to minutes. Sh

A set of ordered pairs in which each input has exactly one output is called a.

Rocky point brewery (rpb) plans to file an initial public offering (ipo) in june 20x3. Olsen & alain, cpas (o&a) has performed calendar year end audits

What is the area of this rectangle?