811647494 811647494
  • 25-01-2022
  • Mathematics
contestada

2z4x+3y+2z and 3x+5y+3z3x+5y+3z

Respuesta :

Аноним Аноним
  • 25-01-2022

Answer:

7x + 8y + 5z

Step-by-step explanation:

i hope this helps :))

Answer Link

Otras preguntas

statement and reasons m<1 +m<2+ m<3=180 whats the reason?
Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A red dwarf is _____ A. the remains of a supernova. B. a hot pulsar. C
A carton measures 3 feet by 2 feet by 2 feet. A machine can fill the carton with packing material in 3 seconds. How long would it take to fill a carton that mea
Color ___ indicates that one color is dominating a picture.
182,886 rounded to the nearest tenth
Helpp Pleasee ASAPPPPP
calculate the perimeter of a quadrilateral 3 cm 2 cm 2 cm 5 cm
people involved in cases that are accepted by the us supreme court must travel to washinton dc?