sophiagreider1 sophiagreider1
  • 23-01-2017
  • Biology
contestada

Which characteristic is present in both embryonic and adult monkeys?

Respuesta :

alay786
alay786 alay786
  • 23-01-2017
The Monkey's Traits: Sharp, Smart... People born in a year of the Monkey have magnetic personalities and are witty and intelligent. Personality traits like mischievousness, curiosity, and cleverness, make them very naughty. Monkeys are masters of practical jokes, because they like playing most of the time. And the characteristic is that they are sharp.
Answer Link

Otras preguntas

While the signalman is describing the actions of the person he sees by the mouth of the tunnel, the narrator says in his mind. "for God's sake clear the way!" w
If two solutions differ in their [H3O+] by a factor of 2.0, the difference in their pH will be 2.0.
what is thunder is cause by?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Desert animals need to concentrate urine. What structural changes in the kidney would be associated with a kidney that is exceptionally good at concentrating ur
Which viruse reproduces & what reproductive cell ?
An ovule can be defined as:
what procedure could you use to test the effect of a catalyst on a reaction
What volume (in milliliters) of oxygen gas is required to react with 4.03 g of Mg at STP?
If 1+4=5 what is 8+11