cynthiahopkins1
cynthiahopkins1 cynthiahopkins1
  • 23-02-2017
  • Mathematics
contestada

please explain equations

Respuesta :

djbutternut14
djbutternut14 djbutternut14
  • 23-02-2017
a statement that the values of two mathematical expressions are equal (indicated by the sign =).

 Here is how to solve the question in the above example using inverses:First, write down the expression:2a + 3 = 7.Then, undo the + 3 by subtracting 3. Remember, you need to do it to BOTH sides!2a + 3 - 3 = 7 - 3,so 2a = 4.Undo the multiply by 2 by dividing by 2, again on both sides:2a ÷ 2 = 4 ÷ 2.
Answer Link

Otras preguntas

How many cm has a inch
what is the solution to the following equation? 9x^2-12x+4=17
how much heat in kj is released by burning 9.5 grams of methane?
Whose image will replace Andrew Jackson on the U.S. 20$ bill
Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?
help answer ASAPPP 10 points
write a sentence using the words limiting factor and carrying capacity
Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut