Sqwilliam
Sqwilliam Sqwilliam
  • 24-04-2017
  • History
contestada

what is an example of a reserved power?

Respuesta :

littlecupid100
littlecupid100 littlecupid100
  • 24-04-2017
Well like a prince or princess for example they have reserved power because they cant become queen or king till a certain time or age.
Answer Link

Otras preguntas

find the equation from the model -2x+6=2
Channels were built in cities in the Indus Valley to transport __________ to homes.
During the holiday sales, a new TV regularly priced at $300 is on sale for $120. What is the percent decrease in the cost of the TV? * 50% 60% 40% 30%
Atoms of oxygen have a total of 8 electrons. Are these atoms stable, and why or why not?.
find the value of y in the solution to the system of equations shown. y=5x+3 2y=18x−10
32. CAMPING Michael is planning to ride a horse to a campsite. The sum of Michael's weight and the combined weight of his camping supplies must be at most 20% o
An unfavorable change in consumer tastes and preferences for a product will ______ demand, which is illustrated as a shift of the demand curve to the ______.
Please help me with Question 1.
Two airplanes leave the airport. Plane A departs at a 42° angle from the runway, and plane B departs at a 44° angle from the runway. Which plane was farther awa
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT