dillonkittle6353 dillonkittle6353

21-09-2017
Biology

contestada

What part of an enzyme determines the substrate on which the enzyme will work?

Respuesta :

22-09-2017

the active site of the enzyme determines it.

Answer Link

Otras preguntas

look at the picture for the problem

A parallel plate capacitor is charged to a potential difference of 100 V and disconnected from the source. A slab of dielectric is then inserted between the pla

-2 9 and -2 -5 slope

evaluate -3+-6/1|7+3|

During photosynthesis, plants incorporate carbon dioxide into sugars and other organic compounds. The ratio of 12CO2 to 14CO2 incorporated into the sugars and o

An shop sells sundaes for $2 and banana splits for $3. One day the shop sold 8 more sundaes than banana splits and made $156. How many sundaes were sold.

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

In a command economy, how is it determined what goods and services will be produced

Push-down accounting is concerned with the Select one: a. recognition of goodwill by the parent. b. impact of the purchase on the separate financial statements

How does the energy of a photon emitted when the electron moves from the 3rd orbital to the 2nd orbital compare to the energy of a photon absorbed when the elec