XXSavageForLifeXX XXSavageForLifeXX

23-10-2017
Biology

contestada

what is the organelle in which photosynthesis occurs?

Respuesta :

metalhead7854 metalhead7854

23-10-2017

The answer is chloroplasts

Answer Link

Ahnigrimes11 Ahnigrimes11

23-10-2017

chloroplast- Is when photosynthesis occurs

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

why can't the position of an electron be determined with certainty?

to increase an amount by 85% what single multiplier would i need to use?

Jonathan has a collection of 400 marbles. Blue marbles make up 17%, percent of his collection. How many blue marbles does Jonathan have?

Suppose a pizza must fit into a box with a base that is 12 inches wide. You can use the quadratic function a=(Pi)r^2 to find the area of a pizza in terms of its

Explain which one of the above market control measures is applicable in the Labour market and justify why it is important to consider the effects of such action

State two biological reasons why you consider that the loss of biodiversity matters.

what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions

a speech is considered what type of text

jon eat 3/4 of a pizza how much pizza is left