hmcmurtury18 hmcmurtury18
  • 24-05-2022
  • Mathematics
contestada

A right cylinder has a radius of 4 and height of 11 . What is it’s surface area?

Respuesta :

r13220358
r13220358 r13220358
  • 24-05-2022

Answer:

376.8

Step-by-step explanation:

formula for SA=2×π×r×h  +  2×π×r²

r = 4

r²= 16

h = 11

π= 3.14..

substitute:

SA= (2 × 3.14 × 4 × 11) + (2× 3.14 × 16)

276.32  + 100.48 = 376.8

Answer Link

Otras preguntas

What is the slope of a line that passes through the points (2,4) and (4,6)?
help me its due today
Giving BRAINLIEST to the CORRECT answer.
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
Which of the following best explains how subsoil becomes rich in minerals?
please help i don't understand ​
To find the perimeter of the rectangle you can use the expression 2 L t 2 w where L and w represent the length and width of the rectangle.Find the perimeter of
Given that the commuter used public transportation, find the probability that the commuter had a commute of 60 or more minutes.
What kind of image is created by a camera lens?
Why, if people are as bad as Thomas Hobbes suggests, would we put our trust in an all-powerful ruler?