kingsteward1002 kingsteward1002
  • 21-11-2017
  • Social Studies
contestada

Which of the placemarks best represent more developed and less developed scenes?

Respuesta :

andriansp andriansp
  • 01-12-2017
1 and 2 = more developed; 3 = less developed is the best placemark.
Developed scenes refers to the type of scenes that provides insight on character's point of view and emotion.
Less developed scenes on the other hand usually only show the rough storyline without indepth subtext of the character.
Answer Link

Otras preguntas

A mining method in which large buckets are attached to a floating Barge
Correct Number Formats Numbers may be entered in several formats - including scientific notation and numerical expressions. WebAssign uses standard scientific
Trigonometry. This is a tangent question. Please help​
Which of the following statements describes all the variables in an experiment? A. All variables are measured to provide data for the experimental results. . B.
Suspecting something, he added: "When you are finished, don't forget to pull the chain. See. That's what the sign says." And, to be sure, there was a paper with
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
¿Cuántos tipos de pruebas hay en el atletismo ?
Find the point-slope equation of the line using the point (5, 3) and slope 3/2​
While Hans and Sophie Scholl were growing up, they initially:
How was the Apollo project different than the Mercury project? A. The Mercury Project tested human survival in space; the Apollo Project sent astronauts to the